Sequenza Alu

Da Wikipedia, l'enciclopedia libera.

Una sequenza Alu è una breve sequenza interspersa di DNA (SINE) originariamente caratterizzata come sito di taglio riconosciuto dall'endonucleasi Alu, un enzima di restrizione. Sequenze Alu di diversi tipi sono presenti in gran numero nei genomi dei primati. In particolare le sequenze Alu sono gli elementi mobili più abbondanti nel genoma dell'uomo e per questo possono essere utili per distinguere DNA umano per esempio da DNA di topo. Queste sequenze derivano dall'RNA 7SL, un componente del signal recognition particle. È probabile che una copia dell'RNA 7SL divenne il precursore dell'elemento Alu nel genoma di un antenato degli Euarchontoglires[1].

L'inserzione di sequenze Alu è implicata in diverse malattie ereditarie umane e in varie forme di cancro.

Lo studio di questi tratti di DNA è stato inoltre importante per la genetica di popolazione dell'uomo e per l'evoluzione dei primati, in particolare per l'evoluzione umana.

Cariotipo di un linfocita di uomo (46, XX). I cromosomi sono stati ibridizzati con una sonda per sequenze Alu (verde) e sono stati contro-colorati con TOPRO-3 (rosso). Le sequenze Alu sono state usate come marker per i cromosomi e per le bande cromosomali ricche di geni.

La famiglia Alu[modifica | modifica sorgente]

Le sequenze Alu misurano in media circa 300 paia di basi e sono quindi classificate come short interspersed element (SINE). Si stima che le sequenze Alu presenti nel genoma umano siano più di un milione e che quindi rappresentino il 10.7% del genoma umano totale. Ciò nonostante meno del 0.5% risultano polimorfiche[2]. Nel 1988 le sequenze Alu sono state suddivise in due grandi sotto-gruppi: AluJ e AluS. In seguito si è deciso di chiamare AluY un sotto-insieme di AluS che includeva gli unici elementi Alu ancora attivi, molti infatti non sono più in grado di effettuare una trasposizione. La scoperta delle sotto-famiglie Alu portò alla ipotesi dei master genes e rappresentò il collegamento definitivo tra elementi trasponibili (elementi attivi) e DNA ripetitivo interdisperso and interspersed repetitive DNA (copie mutate di elementi attivi).

La seguente sequenza di DNA codifica per i 299 nucleotidi dell'RNA 7SL[3]:

gccgggcgcggtggcgcgtgcctgtagtcccagctactcgggaggctgAGGCTGgaGGATCGcttgAGTCCAggAGTTCTgggct gtagtgcgctatgccgatcgggtgtccgcactaagttcggcatcaatatggtgacctcccgggagcgggggaccaccaggttgcctaagga ggggtgaaccggcccaggtcggaaacggagcaggtcaaaactcccgtgctgatcagtagtgggatcgcgcctgtgaatagccactgcactc cagcctgggcaacatagcgagaccccgtctct

Le lettere maiuscole sono i siti esamerici funzionali di risposta all'acido retinoico[4] che si sovrappongono al promotore trascrizionale interno. Il sito in grassetto è quello riconosciuto dalla endonucleasi Alu; l'enzima taglia il segmento di DNA tra i residui di guanina e di citosina. Il nome di questo enzima deriva dall'Arthrobacter luteus l'organismo da cui è stato isolato inizialmente.

Le sequenze Alu formano nei primati un registro fossile relativamente semplice da decifrare in quanto gli eventi di inserzione delle sequenze Alu sono fedelmente trasmessi di generazione in generazione e sono facilmente identificabili. Lo studio di queste sequenze può rivelare quindi relazioni di discendenza in quanto due individui condivideranno una particolare inserzione se hanno un antenato comune. La maggior parte delle sequenze Alu nel genoma umano possono essere riscontrate anche nelle corrispondenti posizioni dei genomi di altri primati, tuttavia circa 7.000 inserzioni Alu sono tipiche degli uomini.[5].

Inserzioni Alu e malattie umane[modifica | modifica sorgente]

Le inserzioni Alu talvolta possono rivelarsi dannose e causare disordini ereditari. Infatti, soprattutto se queste alterazioni avvengono in zone funzionali del DNA come la parte codificante di un gene o il suo promotore, può risultare alterata la sequenza di una proteina o il livello di espressione di un gene. Il primo studio di una ricombinazione mediata da Alu in grado di provocare una ereditabile predisposizione al cancro risale al 1995 e riguarda un caso di cancro del colon-retto.[6]

Le seguenti patologie dell'uomo sono state messe in correlazione con inserzioni di elementi Alu:[7]

Le seguenti malattie sono state associate con singole mutazioni in elementi Alu con ripercussioni sui livelli trascrizionali[8]:

Note[modifica | modifica sorgente]

  1. ^ Kriegs JO, Churakov G, Jurka J, Brosius J, Schmitz J, Evolutionary history of 7SL RNA-derived SINEs in Supraprimates in Trends Genet., vol. 23, n. 4, aprile 2007, pp. 158–61. DOI:10.1016/j.tig.2007.02.002, PMID 17307271.
  2. ^ Roy-Engel AM, Carroll ML, Vogel E, et al., Alu insertion polymorphisms for the study of human genomic diversity in Genetics, vol. 159, n. 1, settembre 2001, pp. 279–90. PMC 1461783, PMID 11560904.
  3. ^ http://www.ncbi.nlm.nih.gov/nuccore/NR_002715.1%7Ctitle=NCBI Genbank DNA encoding 7SL RNA
  4. ^ Vansant G and Reynolds WF, The consensus sequence of a major Alu subfamily contains a functional retinoic acid response element in Proc. Natl. Acad. Sci. USA, vol. 92, agosto 1995, pp. 8229-8233. PMID 7667273.
  5. ^ And Analysis Consortium, The Chimpanzee Sequencing, Initial sequence of the chimpanzee genome and comparison with the human genome in Nature, vol. 437, n. 7055, settembre 2005, pp. 69–87. DOI:10.1038/nature04072, PMID 16136131.
  6. ^ Nyström-Lahti M, Kristo P, Nicolaides NC, et al., Founding mutations and Alu-mediated recombination in hereditary colon cancer in Nat. Med., vol. 1, n. 11, novembre 1995, pp. 1203–6. DOI:10.1038/nm1195-1203, PMID 7584997.
  7. ^ Batzer MA, Deininger PL, Alu repeats and human genomic diversity in Nat. Rev. Genet., vol. 3, n. 5, maggio 2002, pp. 370–9. DOI:10.1038/nrg798, PMID 11988762.
  8. ^ http://www.snpedia.com/index.php/Rs2333227%7Ctitle=SNPedia: SNP in the promoter region of the myeloperoxidase MPO gene

Bibliografia[modifica | modifica sorgente]

  • AF-1(Alu Finder): Un software in grado di trovare sequenze Alu nei genomi dei primati.
Biologia Portale Biologia: accedi alle voci di Wikipedia che trattano di Biologia